Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE053F05
Clone ID 3SE053F05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE053F05
Sequence
TGAGATTGCTTCAAGTTTCTCTCCTTTTAGTTTAATGTTGGCTATTGGTTTGCTGTATATTGCTTTTACTATGTTTAGGT
ATGGGCCTTGAATTCCTGATCTTTCCAAGACTTTTATCATGAATGGGTGTTGGATTTTGTCAAATGCTTTCTCAGCATCT
AATGAAATGATCGTGTGGTTCTTTTCTTTGAGTTTGTTTATGTAGTGGATTACATTGATGAACTTCCATAGACTGAACCA
TGTCTGCATCCCTGGGATGAAGCCTACTTGATGGTGGTGAGTGATCACTTTGGTGTGTTCTTGGATTTTGGTCTGCAAGA
ATTTTATTGAGTACTTTTGCATCAATATTCATAAGGGAAATTGGTCTGAAGTTCTCTGTTGGGTCTTTGTGTGATTTAGG
TATCAGAGTAATTGTGGCTTCATAGAATGAATTGGGTAGAGTACCTTCTGTCTCTATNTTGTGGAATAGTTTGAGGAGAA
TTGGAATAGGTCTTCTTTTGAGTCTGATAGAACTCTGCAAATAACCCATCTGTCCTGGGC
Sequence Type genomic DNA
Unitrap ID UNI22384

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21026790..21027332 519
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020134 (Peli1) NM_023324 pellino 1 Gene [Source:MGI (curated);Acc:Peli1-001]

 
Come back to gene ENSMUSG00000020134


For any suggestions or comments, please send an email to unitrap@crg.es