Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE306D10
Clone ID 5SE306D10
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE306D10
Sequence
GATCTGAACAAAGTGGGCAAATTGGTTGGGCTCTAGTTCTGGCTCTGAATTCATTTATTCATTTTTTCTTAAGGCAAGTT
GCTACTGTCAGAG
Sequence Type genomic DNA
Unitrap ID UNI36019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 93752502..93752596 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059474 (Mbtd1) NP_598773 mbt domain containing 1 Gene [Source:MGI (curated);Acc:Mbtd1-009]

 
Come back to gene ENSMUSG00000059474


For any suggestions or comments, please send an email to unitrap@crg.es