Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST422206
Clone ID OST422206
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST422206
Sequence
GGTTTCCCGAGGTGCCTGAGGCAGCTTGCCAGCTTGGTGTCCCTGGAAGGCCTGAGCCTCTACCACAATTGCCTGAAATG
CCTGAACCCAGCCTTGGGGAATCGTACAGCCCTCATCTGGGTGAAGAGCCGTTGTGTCAAACACAATAAAAAGAAGCCCA
AAGGCCTGTACAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI679

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138074815..138082316 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029720 (Lrch4) NM_146164 leucine-rich repeats and calponin homology (CH) domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1917193]

 
Come back to gene ENSMUSG00000029720


For any suggestions or comments, please send an email to unitrap@crg.es