Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE305F08
Clone ID 5SE305F08
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE305F08
Sequence
GTCGACACTAGTGGACAAAATATCTGATGAAAGTGATTTAAGAAGGGAAGTATTTATTCAGACATGTGATGTGAGAAAAA
GTCCATTGCAGGATGCTTGGTAGTTGGAGCAGGTCCCAAAGATGGCGGCAGGAGGAGGCAGCACACGGTATTGTGGCACA
GTTGAGCTTGGGTGAAAGGTGGAGCCAGGCTGGAGCCCGAGGTCTGCTCTCTAGGGCCTTCCTCCACTTCCTCCAGCTAA
GCCCCACTCCCTAAAGCTTCCACCACCCACCCAAATTGTGTCTCTTGCTGTGGCCCAAGAGTTGATGTAAATGAGCTGGT
GGAAGACATCTCACATCCAAGCTCTGTGAAATACCCCTTATGATGAAGTGTGGTCTGTCTGCATCTCTTCCTTAGCATGC
ACAGCTCGTGTGCTGCTTGCCAATGAGCTGCTTCAGTAACCCTCGTTTCCAGGACGACCACATCCAGTTGTAGGGATGTG
AATCTCTGTAAACTTTCTGCCAGGTGGATTAGGTGACAAAGACAGGTGCTTTAGGAGTTTGAATGAGTGGCAGATGGTAA
CCAAGTCTGCATACAAAGTATCAGAGAAGTGAGTACTGTGGCTGTCCAGATTGGGAGCATGGGAGGTGAGGCTGCCATAG
AACCTGACGTTGCTGAATTCTTCTCAGNTAATGG
Sequence Type genomic DNA
Unitrap ID UNI29989

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 97409171..97409818 638
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028089 (Chd1l) NM_026539 chromodomain helicase DNA binding protein 1-like Gene [Source:MGI Symbol;Acc:MGI:1915308]

 
Come back to gene ENSMUSG00000028089


For any suggestions or comments, please send an email to unitrap@crg.es