Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE305D09
Clone ID 5SE305D09
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE305D09
Sequence
GAAGAGATGTTCNTTCCTCTGTGTATTCTNNNACTCCTAGTCACGGTTTTAGTTGAGGGTGTACTTAGGCTTTGGTTGTT
TCTGAACCNTCTGTTCTGAGGCACTGACCTGGAAGGGCTGCTTTCTGCCAATGCCCACCGATTTGATTACTACAGCCTTT
CGATGTTGCTTTGAGAAAGGGTTCTGCTCGCTCACCTTCTGCTCGTTCTGTAATTGTGTCAACTGTACATGTGTACATAA
GAAGAGTATATTTGTGTTTGCAGGAAGTTCACTATAAAAGAAGCAAATAATAGACCTTTACAAGTAGAACATTCCTTACA
GCTTCATCGATTTTAATGTTCTCAAACATGTCCAAAACACAGTAGGCATTCAGAATATTAAACTGAATTTGAAAAACACA
ACATAAACCCCATTTGTCTCCATTTAAGGACCAGGCCTAATTTTGAAAAGAAAGCCCTAAGGCACCAGCTCCAGGAACAG
ACCATAAATAAGATCATAAAACTCTCTCCCAAAGAACAGCCTGGGGATAACCACAGAAATGGAGAAATAGCTTATCTCAG
AATGGGCCCTCTGTGCTCAGCAGCCTTATCTCATTCTACAGTTGCACACTCATAACACAGGAATGCAGACTGCTGACCAC
CTGTGACCCTCTAGAACCCACCAATGAAATTTTAGATTACCCAATCCTTCTAGA
Sequence Type genomic DNA
Unitrap ID UNI32911

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 119605282..119605977 668
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020227 (Irak3) NM_028679 interleukin-1 receptor-associated kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1921164]

 
Come back to gene ENSMUSG00000020227


For any suggestions or comments, please send an email to unitrap@crg.es