Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE305D08
Clone ID 5SE305D08
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE305D08
Sequence
TCTAGGCTAGCTCTCATGCCTGTCCGTGCTTTGGAGCCCCTCCCTCTTCCCCCTCCCACCTCCTCATGCCAGGCCCTTCT
CTTTCTAAGGGGCTTCAGACCTTATTTGGTGAGTTCTGGGCCAGCCTTCTGGGGGCATCAAGGCCCGCCCTATGATGTCA
TCCCCATGGAATGTAAATAACCTTCCCAGTACTAGGCAGGCTGAGGAGGAGTTTTCCTGCCTAGGGACCCTGAACCACTT
CCTTCTGGAGTTCCCCACCCCAGCCCCCACCCTTGAGAAACTCCCGGCTGCCATCCCAGTAGGGCTTCAGCGATGTTCCT
GTCATGTGCTGGTCACATCTATGAGCCTACTGCTAGGGAAGTAGGGACATCTCGTGCCAGGGATGTGAGACTCAGACTGA
AACATAAGATGGGACACTGGAGAGGCGGCTCAGTGATTACAGCACCAGCTGCTCTTGCAGAAGTCCTAGGTTCGATTCCC
AGCAACCACATGGAGGCTCACAACCACCTGTGACTCCAGCTCCAGGAGTCTGACACTCCCACTGGTCTCTGTGAGCAAAA
CTTGTAAAAACACAGAAAGAAATACAGAGCCCTTTTCATATGCCACACACCAACTCACCCTGACAGGTAAGTATGGACAA
TTTAGCCCTTACGTAGTCAACA
Sequence Type genomic DNA
Unitrap ID UNI5232

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80647541..80648204 642
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034974 (Dapk3) NM_007828 death-associated protein kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1203520]

 
Come back to gene ENSMUSG00000034974


For any suggestions or comments, please send an email to unitrap@crg.es