Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE305D02
Clone ID 5SE305D02
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE305D02
Sequence
GATCTGTTGATTACTGCCATGATATGTATGTCACTAATGCACAATTATGGTTATCATGCCATGCTGGTCATTATTGTGAT
TCATAGGCATCATACCTGGGAAGGACTGTTGGTTACTTTTGTTCCTTGGAAGCATGCATAGTGCCTTTTGATACCATGAA
AACTGCTCCTCAGTCCAGAGTTCTTGGAGGTCTCTATCTGAACTACATAGTGTCCTCAGATATAGGTTTTAGTACAGAGT
CTTTGTGACACTCACCTCTATATACCCTCTCCAACTGGCTC
Sequence Type genomic DNA
Unitrap ID UNI26282

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 76895929..76896209 281
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046942 (2410003J06Rik) NP_082301 melanoma antigen family B, 16 Gene [Source:MGI Symbol;Acc:MGI:3644898]

 
Come back to gene ENSMUSG00000046942


For any suggestions or comments, please send an email to unitrap@crg.es