Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE223E08
Clone ID 5SE223E08
Vector rsFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 5SE223E08
Sequence
GATCTTGTTACAGATGGTTGTGAGCCACAATGTGTCGCTGGGATTTGATCTCTGGACTTCGGAAGAGCAGTCGGGTGCTC
TTACCCACTGAGCCATCTCACCAGCCCAATTTTTTATTTCAGCCATTAAAGTTTTTCAGAATGTTACTTGCTGTTGGAAT
TCTGGTGGTTTCATGAATTTACCCCATCAACATATTTTCTGGCAAGCTCCTATTTATGGTTGATGGACAGTAGCCCAGTC
ACATGTCCTGCTACATTGTGTCTCCCTACAAGCAACTACCAGAGGCTGATTCCCTTTCCTTACCAAGCATTTCAGCTCAA
AGCTGCCTTATACTGGAAGGAAAATGCACTCTAGTCCCAGTAGCCTCTGGGGAGTGGACTTGTGGAGTATGTGTCAGGCT
TATATTAAAGAATATTCAGAGCTGNNTCATNTGCATGCAGGGCTTTCTCCTCCCTGCTT
Sequence Type genomic DNA
Unitrap ID UNI31282

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9310750..9311102 337
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048264 (Dip2c) NM_001081426 DIP2 disco-interacting protein 2 homolog C (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920179]

 
Come back to gene ENSMUSG00000048264


For any suggestions or comments, please send an email to unitrap@crg.es