Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE223C04
Clone ID 3SE223C04
Vector rsFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 3SE223C04
Sequence
CCAGTTAGATGACTTNCGCTTGCTATTCAGACTGGCTGGCAGTAAGTTCTAGGAATCTTTAATTTTTGCCTTTCTGAGGC
TTGAACCTACAGCCAAATCCTCCCCCTCACAGTGGAATGTGGGGGAGGGGGGAAAACAATTTTATACTTATAAATATCTG
TTTTATAAAACAGTCAACACATATATACTAACATATCATCTGCAAAAAGTGATATTTTGACTTCATCTTTTCCAATTGGA
AGGAGGTTACAGAGACAAAGTTTGGAGCTGTGTCAAAAGGATGGACCATCTAGAGCCTGCCATATCCAGGGTTCCATCCC
ATAATCAGCATCCAAACGCTGACACCATTGCATACACTAGCAAGATTTTCCTGAAAGAACCCAGATATAGCTGTCTCTTG
TGAGACTATGCCGGGGCCTAGCAAACACAGAAGTGGATGCTCACAGTCAGCTATTGGATGGATCACAGGGCCCCCAATGG
AGGAGCTAGAGAAAGTATCCAAGGAGCTAAAGGG
Sequence Type genomic DNA
Unitrap ID UNI16210

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74796819..74797207 369
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024069 (Slc30a6) NM_144798 solute carrier family 30 (zinc transporter), member 6 Gene [Source:MGI Symbol;Acc:MGI:2386741]

 
Come back to gene ENSMUSG00000024069


For any suggestions or comments, please send an email to unitrap@crg.es