Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE223C03
Clone ID 5SE223C03
Vector rsFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 5SE223C03
Sequence
CATGNNGCTCAGAACAAACAGAAATGTGGCTTCTAGGGGTCTGTGGTCTGTGTCTCCACACTGGAGGGAACTGTGGGCTT
AGTGCCTCTGCCACGGCCATAGTGTGCCAGTCTTTGAGATAAGAGGGTGTCAGCTTCTTCCCTCAGCTCCTTGCTCTGCT
CATAGTAAACGTAAAGACCCTGGGCTCAGGCAGAGGAACGGTGCTGAGGTTGGAAAAGGGCAGTCAGCCTGGGGACCAGG
GAACCCCAATGAAAGCACCTTAAGTACTCTGAGAACTTGGTTCCCAGCTCCAGCTTAGCCTTCTGCCTTTCCCTCCCTGA
CTGCCTGAAGCTAAGTGTTTCTAGTCTTTTGGTCCTGGAGGCTCATGAAAAACTGGCCACGTAT
Sequence Type genomic DNA
Unitrap ID UNI679

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138073031..138073415 367
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029720 (Lrch4) NM_146164 leucine-rich repeats and calponin homology (CH) domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1917193]

 
Come back to gene ENSMUSG00000029720


For any suggestions or comments, please send an email to unitrap@crg.es