Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE167E02
Clone ID 5SE167E02
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE167E02
Sequence
GATCTCTGAGAAGAGGTCAGCTTGGTCTACTTAGTGGCTACATGAAAAAGGCCTTGTCTCCAAAAAGAAAAAGAAAAGAA
AAGGTAGTTTTAGCTGCTAAACATCCTAACTGGCTACATAGCAAGTTCCAGGACAGCCAGAGCTACACAGTGAAACCCTG
TCTCAGGAAACAGAAACAAAAGAAGCACAAGGACAAACGAGAGCCCTAACTGGTGTTCATTTTATTACGGTTTTTATTTG
GGTCAGGGTCTCACTACAAAGTCTGGCTGCCTTGCCGTGGTTGACAGATTCATTTCAAACTGCTGAAGTCCCGCCTGCTT
CTGCCTCTGCCTCTGCCTCCCTCAGCACCAAGGTGTCAGGTATGCGACACTATGTCCTCGTGGTAAATTTACTTTAAACT
TTTAGTTGAAAAGCGTTAATGCCAGCTTTGGTGGTCCATTGATAAAGAGATGTAGAGATACAGAGATGTAGAAAATGTTT
CTCACTGTCCCAAAGAATGGTGTGGTTATAGTGGAATTTGAAGTTAAGACCCAGTCTACTGACTGAACTCAAATCATTGT
TCTTCAGTCCATCTGAGCCACTCTGCTCTTAAACTAACAGGTGAAGCAATTAAGAGAGTAT
Sequence Type genomic DNA
Unitrap ID UNI21327

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34714323..34715119 531
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009630 (Ppp2cb) NM_017374 protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform Gene [Source:MGI Symbol;Acc:MGI:1321161]

 
Come back to gene ENSMUSG00000009630


For any suggestions or comments, please send an email to unitrap@crg.es