Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE167C08
Clone ID 3SE167C08
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE167C08
Sequence
GTTCTCGCTGGTGGTGTTTAAGAGCTGAAGTGCTGCCCTTTGGACCCAGCCTGTTTTCATTTCTGCTCTCAGCTGTCTGA
TCTCCATGGACCTCACCTACACGTTTGTGCGTGCCCGTCCCCCACGATGCTGCTTCACTAGGCCCCTCAAGCCTGGCACA
CTCTGGTCTTTGTTCTCTATAGAACTGCCAACTCTGTGCCTGGACTGGGATAGCTTTTCTGGCTCTGTTACTCGCCTAGC
CACACCTTCCCCAAGACCACTTCTTTCTTTAGCTGCATTCTGGGGGCAATGCTTGGCCTTGAACTCACAGAAATCCACTT
ACCTCTGCCTAGGTACTAGGATTAAATTCATGTGCCACCACAACTGGCTCTGCTAGNGATTATTTATTTATTTATTTATT
TATATGAGTATACTGTAGCTGTCTTCAGATACACACCAGAAGATAGCATTGGACCCCATTACAGATGGTTGTTAGTCAAC
CATGTGGTTGCTGGGACTTGAACTCAGGACCTCTGGAAGAACAGTCAGAGCTCTTAACCACTGAGCCATCTCTCCAGCCC
CACCTCTAGTTATCTTAAAGCCCATGCACAATCTTGGGTCAACATCTTCCCTGTGGAG
Sequence Type genomic DNA
Unitrap ID UNI16383

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152619546..152620156 589
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007659 (Bcl2l1) NM_009743 BCL2-like 1 Gene [Source:MGI (curated);Acc:Bcl2l1-001]

 
Come back to gene ENSMUSG00000007659


For any suggestions or comments, please send an email to unitrap@crg.es