Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE152H02
Clone ID 5SE152H02
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE152H02
Sequence
GATCCAACATGGGCTTGTGTGAGTATGTGAAGC
Sequence Type genomic DNA
Unitrap ID UNI36894

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 146433465..146433497 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005034 (Prkacb) NM_011100 protein kinase, cAMP dependent, catalytic, beta Gene [Source:MGI (curated);Acc:Prkacb-001]

 
Come back to gene ENSMUSG00000005034


For any suggestions or comments, please send an email to unitrap@crg.es