Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE289G09
Clone ID 5SE289G09
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE289G09
Sequence
GATCTTAGAACTAAAACTGAGCAAAAAGTCTAGGACTGGTGTCTGTCACATGGTGAAACACAGTTACTATTTATGAAGCA
AGTTTTCATGAGTAATATCAATTTTAAGTAGCTTAGTCCTGGGCTGGAGAGATGGCTCAGCGGTTAGGAGCACTGACTGC
AGTTCCAGAGGTCCATCCATGTCATAG
Sequence Type genomic DNA
Unitrap ID UNI30296

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71910781..71910954 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049044 (Rapgef4) NM_019688 Rap guanine nucleotide exchange factor (GEF) 4 Gene [Source:MGI (curated);Acc:Rapgef4-003]

 
Come back to gene ENSMUSG00000049044


For any suggestions or comments, please send an email to unitrap@crg.es