Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE289G02
Clone ID 5SE289G02
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE289G02
Sequence
GATCCCATTACAGACGGTAGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCAGGACCTCTGGAAGAGCAGTCACTGCT
CTTAGCCACTGAGCCATCTCTCCAGTCCTGCTTCTGTTTTTCTTACAGTGTATGGCTAGAACATATAATGGGTATAATAC
AAAGCTTATACTAGTATAAGCTTTTAAGTAACTGTACGACTGCCGTGGGCCCCCGTGCTAGTCTTATGCAGTACAGGGAT
CAGATCAAGGGCCTTGTGTGTGCTAGGGAAGCACACTGAGCTGTGTCCCTAACCTTAGCCCTTTTGGAGGCTGACAGGAC
AGTTCTTTCTTCCTTTCTTTCTTCCTTTCTTTTAAAAATGTATGTGTATGATGTGTTTCCTAAATGTCTATATATGCCTT
GTGCCCAAGGGGATCAGAAGAGGGTGTCAAATCCCCTGGAACTAGAGTTAACAGTGGTTG
Sequence Type genomic DNA
Unitrap ID UNI27096

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106226958..106227417 448
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023345 (Wdr51a) NM_027354 WD repeat domain 51A Gene [Source:MGI Symbol;Acc:MGI:1917485]

 
Come back to gene ENSMUSG00000023345


For any suggestions or comments, please send an email to unitrap@crg.es