Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE152E03
Clone ID 5SE152E03
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE152E03
Sequence
ACAGAGTTTAGTCTATTGGGGTTGCTCCCGGAGCTGGTTTGGGATATGGCTGCTCTTGTCTTGTGTTTTTGTTACAGCAT
GTCTTCCTCCTCCGCTTAGAAAATGGCGGAGCGACGTGACTCAACCCCCATATTCCTGCCTTCTTCTCAGCTTGGAGTCT
CGAGATGAGCCTCCTTTAGCAGCCTAAAATGGGTTAACCCTGAAAAGCCAAGAATTGAGTTTCATAAGGCCATGAGATTC
TGGGGAGGAGATGGACGGCATTACAGTATGTGATCTCTGCAGCAGATGCAACATAAACTTGTGAAATTGTACTCATGTAA
AATTCTTATTATCCCTGCCCAATGTGTTCATTGCCTTTTGCTTTTGTGAATGGTAATGTTTGCTGTGTTTCATTGCCTAC
AAACTTTATGTGTAATGGCAAAAGCAGTTTTGAACAGCACCAACTGTTGAAGTCTTGTGGTCAGCTGTATAAAAGAAAGC
CTCACTTGACAACAGTTTGATAAATAGTTTCAACCTG
Sequence Type genomic DNA
Unitrap ID UNI1453

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 61716607..61717123 493
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024576 (Csnk1a1) NM_146087 casein kinase 1, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1934950]

 
Come back to gene ENSMUSG00000024576


For any suggestions or comments, please send an email to unitrap@crg.es