Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE152D02
Clone ID 5SE152D02
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE152D02
Sequence
GATCCACACAGTGTGGCATAATCACTATTTCTTCACAATGGCTGGCAGCACACTTCTTTGCATTTAATAAACTAGAACAA
TGATTAAAGCTTTGGAAC
Sequence Type genomic DNA
Unitrap ID UNI18365

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103689358..103689456 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034187 (Nsf) NM_008740 N-ethylmaleimide sensitive fusion protein Gene [Source:MGI (curated);Acc:Nsf-001]

 
Come back to gene ENSMUSG00000034187


For any suggestions or comments, please send an email to unitrap@crg.es