Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE152A08
Clone ID 3SE152A08
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE152A08
Sequence
GGTAGCTTCCTATCACTGATGGACTTTGCATTTCAAAGACCTGCAGTTTCTTGGTCCTTTCAGCAGTTCTGAAAGATTGC
TGTAACTAGCTTCTGTTGCTCAGATAAAATTAGAAAGCTTCCACATCTGAACCCAATAGGGCCTGAACGTTTAAACCAAG
TCCCATTGGTCCTCCTCATTGAAGTAAGCAATTTCAACAGCCATACACTTATTATGCATTCCAATAACATTCATTTAAAG
TCACACCTGAGATTTTTAGATGGATACTTTTCTTGCCACTTAGCTTTTAGGAAATTTAACTAG
Sequence Type genomic DNA
Unitrap ID UNI36897

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 21168181..21168486 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039599 (AA536717) NP_001019683 family with sequence similarity 149, member B Gene [Source:MGI Symbol;Acc:MGI:2145567]

 
Come back to gene ENSMUSG00000039599


For any suggestions or comments, please send an email to unitrap@crg.es