Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE142H05
Clone ID 5SE142H05
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE142H05
Sequence
GATCTCTGAATTTAAAGCCAGTCTGGCCTACATAGTGAATTCCAGGATGGCCAGGGTTACATAGAGAGACCCTCTCTCAA
AAAAAACAAAACAAGCCAAAAAAAGTTGTCAGTTATTTTCAGTCTGTTTGAGCTATTCCCATGGTTTTCTGGAAAGCACC
TGATTTATCATCCCTTTTTAATGTGCCTGAAAGCAAATAGATGAACAACTATGATACCAGGTCATCCTTTTATGCCTGCA
GCTAGAAACCAAGGTGCTTGGAGTAAGGCAGAAACCCAGAGGCTAATCAAGGCTGTGGAGGACGTGATCCTAAAGAAGAT
GTCTCCCCAGGAGTTAAGAGAACTGGATTCTAAACTCCAGGAAAGACCTGAGGGTCGCCTGTCAATTGTCCGGGAAAAAC
TCTACAAGGGCATATCTTGGGTTGAAAGACCNNCGCGACGGTAGCATCTAAAGTCGACAAAAATT
Sequence Type genomic DNA
Unitrap ID UNI31512

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28929853..28930277 415
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026803 (Ttf1) NP_033468 transcription termination factor, RNA polymerase I Gene [Source:MGI (curated);Acc:Ttf1-001]

 
Come back to gene ENSMUSG00000026803


For any suggestions or comments, please send an email to unitrap@crg.es