Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE288D07
Clone ID 5SE288D07
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE288D07
Sequence
GCGTGGCCCTCAGTACGCACGCCCTACGCCTGCGTCATCGACGCACGCAACGTGTGACGGAATAATCTAGTTTATATTGG
CGCGGTCCGGACGGCAGAGGCCTCTGCGGCGCGGTCCTCGGAGCGGCGCGGTTCTCGGAGCCACGCGTCTGTCTTCCTCC
GTGGTCATGGCGGACTACCTGATTAGCGGAGGCACCTCTTACGTGCCGGACGACGGGCTCACAGCGCAGCAGCTCTTCAA
CTGCGGGGACGGCCTCACCTACAAGTGCGGGTCTAGGGCACCCATCGGGGCGAGGCGAGGGGCCGCACGCTGGCGAGAAG
GCCGGATGAGGGAGGGCTTCATTGAAACTGGTGGGAGCGGATGGGGAACAGAATGCGAGAATTATTTATCGCCGAAGACT
CACTTCGACATAAGGAAGCAGTTGCAGGGCTTAGAGATCGCTG
Sequence Type genomic DNA
Unitrap ID UNI20797

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108462698..108463136 409
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062867 (Impdh2) NM_011830 inosine 5'-phosphate dehydrogenase 2 Gene [Source:MGI Symbol;Acc:MGI:109367]

 
Come back to gene ENSMUSG00000062867


For any suggestions or comments, please send an email to unitrap@crg.es