Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE287D10
Clone ID 3SE287D10
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE287D10
Sequence
CCGTTCATGAGCTTGGGCATGGTAACGCCAAGTTATATGGTANATTATAGAGTAACTTACTGAACTGGGGGTCAGCTGTG
AGTCATAAGCACACTCAGCCACGCCCGGCTTTTTGTATGAGTGCTGGGGATTTGAACTCAGGTTCTCATATTCACAGAGC
AAACACTCTTACACACTGAACCAGGCCACCGCCTCCTTCTCCTTCTCCTCCTCTTCTATCTCCTCATCTTCCTCCTCCTT
ATCATCTTCTTCCTCCTTCTCCTCCTCCTCCTCTTGTTTTTTCAAGACAGGGTTTCTCTGTCTAGCTCTGGCTATGGTGA
AACTGCGGATCAGGCTGGCCTCTGCTTCCTAAGCACTGGGATTAAAGGTGTGCACCACCACCATCCGGTCTATTTTCTAA
ATTTGTTTATAATAAATATATTATTCCTTTCATGATTTTAAAAATTGTCTAGAGCTGGCAAGATGCCTTAGCAGGTAAAG
GCACTTGTCACCAAGGCTGATGGCCCGCGTCCCATCACTAGAGCACACACGGCGGGAAGAGAAAACTGACTCACCCCTAC
CTCTTTATACATGTGCCTTGGTATACACAAGCTCCCCCTGCCCCGTAAATAAATATAACTCAAAAATAAAACATATTATC
TAANCACATTCATAATAAATATAAAGTGTAAGAATAACATTGTACTAATGTCTNCACGAATTAAATAAATATGTATTGAA
AAAATAAGTAGTGGGGCTTGCAGAGGACACCCCAGCACATGCAGC
Sequence Type genomic DNA
Unitrap ID UNI5488

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81995124..81995876 725
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022463 (Srebf2) NM_033218 sterol regulatory element binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:107585]

 
Come back to gene ENSMUSG00000022463


For any suggestions or comments, please send an email to unitrap@crg.es