Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE287C05
Clone ID 5SE287C05
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE287C05
Sequence
GCCTTTGTGCTCGGCTGTCCCTTGTTCCCGCAGAGGCTAGCGAGGTCGGGAAGAACCCTCCATTGTGAATCCATTGTGGT
CTGAGACTGGACGGAAGGTTCGGCCAGCCTGTGTGATTAGAACTGCGTCTTGGGAGTGCCTTTCCTGGATGTGGACAGAG
ACTCTTGACAGGGTTTGAAGTGAAAATGAGAACTAGTAGGTAATTATTAATTTGATTTAATGCAATAAGAGAAACACATT
TGCATATATGTTTAGCAAATGAGCAAGGGTG
Sequence Type genomic DNA
Unitrap ID UNI29946

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33010200..33010470 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040183 (Ankrd6) NM_001012450 ankyrin repeat domain 6 Gene [Source:MGI (curated);Acc:Ankrd6-002]

 
Come back to gene ENSMUSG00000040183


For any suggestions or comments, please send an email to unitrap@crg.es