Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE286H08
Clone ID 3SE286H08
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE286H08
Sequence
CCCGGTCATTACTTGGACCTTCTTGGCAGAAGAAGGCAATTGACACACTTTAAGTAGCGAGGGTTTTCAATGAACGAAAG
ATGTTGACGCTTACAACCAGAAATGCCTTAAAGTCTAAAGTAGACAGAAATCTTTTTTTCTGTTATTTTTATTTTGGAGC
TGTGTTGAACAGGCAAGTTTGTTTTTGTCTCTACTTTGGTGGTTGTTCACTTATTTCCTCCCTGAGTAGCTAGGATTATC
TCCCAGTGTGCCTCTTCACTTGACACAGAAATTTTATATTACAAACTCATCAGCCTAAGAAGTTATGTTGCTGAGCTTCG
GGTGCCATTCAGCAGTGGAGCACTTGCCTGTTCTGAAAACGGTGTAGTATGGAGCAGGGAATTCCATGGAGAGTAAATGT
TTTGGGAAGATAATTGTTTTGATTCATGGCAAGTCAAGAGAGTGTTTGGAAAAGGATTAAGAAGGTCCTGACTCGATGAA
AGTTGGTGTGGGGAAATCTCAGTTGGTAACGCCGGTTTCTGAGGCTGTCAGTTTTTTTTTTTA
Sequence Type genomic DNA
Unitrap ID UNI10410

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121333006..121333540 489
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027242 (Wdr76) NM_030234 WD repeat domain 76 Gene [Source:MGI (curated);Acc:Wdr76-002]

 
Come back to gene ENSMUSG00000027242


For any suggestions or comments, please send an email to unitrap@crg.es