Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE286F06
Clone ID 3SE286F06
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE286F06
Sequence
CCGGGTAGGTNTNATATATGCTTTATAATAATGTATTTGTAGCTTCACAGGCTACGGGTATTTTATATACGTGGTTCATA
TGAGCTTCACATGACCATCATGGTTAAGGTAGGAATTATTGTTTCCATTTTTCAGATGGGAAATTTGTGATTTAAGAAAT
GGAAGACTCCCATAGAGAGACCCTTAGGTATCTATTTATCTAACAGTACAGTAGCACAGTATAGACTCAGGGTGCCAAGC
TTTGG
Sequence Type genomic DNA
Unitrap ID UNI30180

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58458972..58459208 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032336 (Nptn) NM_009145 neuroplastin Gene [Source:MGI Symbol;Acc:MGI:108077]

 
Come back to gene ENSMUSG00000032336


For any suggestions or comments, please send an email to unitrap@crg.es