Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE286D10
Clone ID 3SE286D10
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE286D10
Sequence
CCAGCTCAGTAGATGTTTCATTTCAGTCATTATTACTGACTAGTTAATGTTCTTCATGACTTTTCTCATAAAACAGTCCA
GTCTCAATACTTGTGAATCTGTACATATCAAAATAGCTCATGGAAGAAATTTCCTGTAGTCTTTTTTTTTAATTAATTAA
TTTATTTATTATATGTAAGTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGGCATCAG
Sequence Type genomic DNA
Unitrap ID UNI36904

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 13634234..13634440 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037808 (2810485I05Rik) NM_176836 RIKEN cDNA 2810485I05 gene Gene [Source:MGI Symbol;Acc:MGI:1920076]

 
Come back to gene ENSMUSG00000037808


For any suggestions or comments, please send an email to unitrap@crg.es