Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE307G04
Clone ID 3SE307G04
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE307G04
Sequence
TTTTCCGCTCAAAGCGCNTCGGTTTGGGGACCCATTATTTTTTATCACTCCCCTGTCCTTGCTTTCACATTTATCATCTG
GAGTCCAAGGACTCATCAGAGGGACTTGGCTTGGCAGGACGACGTCCCAGTGCGATGAGAGTCCGTCTTCTGCATTTTCC
TACCCCCTCCACCCTCCCCTCAAAGCCATCCATCCTCCAGCGTTCTTTCCCCCTTGAACGTGCATCCGCACACGGACCCA
GTCCGGGTGACAGTGTGGCTCTCTCTGATCATCAGATTGTTGTGTCCCTGAGGACAGGGGGACGCTGCCGCGTTCAGCAA
GCACCCGCCAGGTAGGTGCTGTGTTGTTATTATCCTGGAAGTGGGTTTCGCAAGAGAAACTCCCAAGACCTCGCTGGACC
AAGAATTAACAGTTAAAAGTCAGGTTTCAAACCCCGGGGTAGCTAGGAACCTAGAGAGAACCTGCCGCCTTCCAACTGTT
CACCCTGTGGGAACCCAGGATGTCCAGTGGTTGAGGAGAGGTTCAAAAACAAAAACCCAGCTTTCCTTTTGTCCGACTTG
GGGTTTCTGCCGTGTGTTTCCTACTTTGGAGATTTCAAATTTGACATAGGTCTGG
Sequence Type genomic DNA
Unitrap ID UNI134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122608735..122609343 581
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004455 (Ppp1cc) NM_013636 protein phosphatase 1, catalytic subunit, gamma isoform Gene [Source:MGI (curated);Acc:Ppp1cc-001]

 
Come back to gene ENSMUSG00000004455


For any suggestions or comments, please send an email to unitrap@crg.es