Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE285C04
Clone ID 5SE285C04
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE285C04
Sequence
ACATGACTGGAATTACACAATATTTCTAATTTTATGGCAGGCATATTATTTCACCATGTCTTCAAGGTTCATCCAGGTTG
TTGAATGTATCAGGATTTCATTCCTCTTTCAGGGTGAATACTATTTTGTTACATTTGCAGACACATTTTGTTCATGCGTT
CATGTGCTAAGGACACTTGGGTCACTGTGACTTTTGTGGGGGTGTTGCTAGGCACATTAGTATATAATTATATGCTTGGA
TATTTTTTTCAGTTCTTTTGAGTATATATCTGGAAATTGGAAG
Sequence Type genomic DNA
Unitrap ID UNI10340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58095628..58095910 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036986 (Pml) NM_178087 promyelocytic leukemia Gene [Source:MGI Symbol;Acc:MGI:104662]

 
Come back to gene ENSMUSG00000036986


For any suggestions or comments, please send an email to unitrap@crg.es