Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE285A05
Clone ID 3SE285A05
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE285A05
Sequence
TTTTTCGGATCATTCTATTGNACTGGTGTGNCAACAAGTANATCAATGAAATATTTCAAACTTTGATACTCTAAACTCAG
AAACAGTGTTGGGCATTTCAGATTAGAGGTCTCAATGCCTAGTTACCACATTGTGTAACCTGTGATTTTTTTTCTCTTCT
AGGCTGCTAAAAGAGGAATTCTTTCATCTGGCCGAGGTAGAGGAATTCATACAAGAGGTCGAGGTACAGCTCACGGCCGG
GGCAGGGGTAGAGGCCGAGGCGAAGGTGTGCCTGGGCATGCTGTAGTGGATCACCGACCCCGAGCACTGGAGATTTCTGC
ATTTACAGAGAGTGATAGAGAAG
Sequence Type genomic DNA
Unitrap ID UNI36910

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 105523820..105524140 302
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022119 (Rbm26) NM_134077 RNA binding motif protein 26 Gene [Source:MGI Symbol;Acc:MGI:1921463]

 
Come back to gene ENSMUSG00000022119


For any suggestions or comments, please send an email to unitrap@crg.es