Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE307B10
Clone ID 5SE307B10
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE307B10
Sequence
TTTCTGAGATACAGCATTTTTATGGAGTTAGAGGCAGTAATAGAAAGTTGCCCTGGAGTCATGCCGAGCTTCCTTTAAAT
CTTATCTTCAAATTGTCTTAGTTGGATTAACTATCGAGATGAAACATCATAACTAAGCAATCTGTGGAGGAAAGAACTTA
TTTAATCTACACTCTCAGGTAACAGTTCATCACTGAGGGAATTCAGGGCAGGCACTAGGAGGCAGGAACTGATGCAGTGC
CCATGGAAGGGTTCTTTTGCCGAACAGGCCTGGGCTCGGCCCTAGTGGGGTCCCAATTTCCCCACACGGGGGGTCTGTGG
GGGGGCCCCCCCCTGGGGCAGCGTCAAAAATAAAAAGAGTAAACCGCACGTCGTCGCAAGTAGATCATCGCATTTGACGG
GAACCTCCTGCGGGGTACCATAGCCAGTTCTAGCTCACAG
Sequence Type genomic DNA
Unitrap ID UNI36911

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 70066336..70066590 243
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039298 (Cdk5rap2) NM_145990 CDK5 regulatory subunit associated protein 2 Gene [Source:MGI (curated);Acc:Cdk5rap2-001]

 
Come back to gene ENSMUSG00000039298


For any suggestions or comments, please send an email to unitrap@crg.es