Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE307A09
Clone ID 3SE307A09
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE307A09
Sequence
GGGCGCTCAATACAATATTTATTCCGGTTTTTTACGGTGCCACACACAAAAGGGAGCTTATGGTGTATAAGGGCAGGTCT
GGGGTTGAGGCTTCTCTGAAATGCAAAGGTACCGCCCAGCCACTGTGGAGGTCTGAAATAGACGCTGCATTTGTGTTACA
CTCATGAGTCCACGCCTGGACACTCAAGCATCGATGAAAAACTTACATGCAAACCTGACAACCCAAGCCTGCTCCGAAAA
CCCCCAGAGAGATGAAAAGAAAGGGAGAAGAGACTCCACAGAGCTTTCCCCTGCCCTCCATGTATATCCTGCAGCTTAGC
ACAGAATAACTAAACAACAAAAACTTGCAAAACCTATTTTACACAGCCCCATGTATTTAAGCTATAATTTTATATTTAAC
TTTTAACAGGAATTTATCCTTGCATTTTAGCAAACCATTGTTTAGAGAAATGAAGTATGGTTGTTGTTAATACAAGAATC
TGCAATAGAAAGTAACTGTTTCTTCCTTCTCCTTCCCCACTTTTGATTTCAGAGACGCTGCAAGCCATAGAGCAGCTAAA
AGAGCAGGCAGCCGCCGGGAAACAGCTAGAAAAAAATCAGGTAAGCCCTCGCTTTCCCTTTGGTTCAGAGTCGTTAGCAC
CCTGTCCTATTTAATATAGGCAACCCTTCAGTCAGAAAGAGAAGCATGCAC
Sequence Type genomic DNA
Unitrap ID UNI20815

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 58359971..58360652 652
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027810 (Eif2a) NM_001005509 eukaryotic translation initiation factor 2, subunit 1 alpha Gene [Source:MGI (curated);Acc:Eif2a-001]

 
Come back to gene ENSMUSG00000027810


For any suggestions or comments, please send an email to unitrap@crg.es