Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE284F05
Clone ID 3SE284F05
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE284F05
Sequence
CCGCTTCAGAGCTTTACTAGGGGCTGGTGAAAGCTTCAGAGGCTTAGTCCATTATCATCATGGCAGCAAGCATGGTACTT
GGTAGCTGACAGCTACACCCTAATCTAGAGACAGGACAGACTGAGACAGCCTGGCGTGGGCTTCTGCAACCTCAAAGCCC
ACCCTAGTGACACACACTTCCTCCTATAAGGCCACACCTCCTAATCCTTCTAATCTTTACAAACAGTTCCACTCCCTGGT
GACTAAGCATTCAAATACATAAGCCTATGGGAACCATTCTTTTTTTGTTTGTTTTTGTTTTTCGAGACAGGGTTTCTCTG
TATAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCACCTGCCTCTGCCTCCCG
AGTGCTGGGATTAAAGGCATGTGCCACCAAGCCCGGCTTCTTGTCTCTTCTTAAACACCCACATAATTCCAGTAATTTCA
CTCTGAAGAACCACCATGTCTATTCTGACTCCTGGATTTTCTTTTTACTGGAGCCACAAGG
Sequence Type genomic DNA
Unitrap ID UNI19421

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120792164..120792693 518
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048445 (Ccdc57) NM_027745 coiled-coil domain containing 57 Gene [Source:MGI (curated);Acc:Ccdc57-001]

 
Come back to gene ENSMUSG00000048445


For any suggestions or comments, please send an email to unitrap@crg.es