Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE306H07
Clone ID 3SE306H07
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE306H07
Sequence
TTGGGTCGCTCCAGCNTCACGGCAGGAATCTGCCAGTACCCCTGACCTGCCTTGACTCTGCCTGGCGGAGGCCTTTTATT
TATTTTCTTTCTCTCCACAGAAGCAGGCAAACGGCTTCTGACACAACCATGCCCTTTTACCCGGGTTCTAGATTAGAGGC
ATGAAGCTGCTTGGCGCTCTGTAGGGGGAGCCCTCTACCCACCCTGTGGCATCTGGCACTGTTCTAACAGGAAGTAGGTT
GTTAGGGTGAGCCTTTCATAAAAATAACCCATTGTGTTATCTCCAGTTTTGGAGCACACACACACACACACCGCCCCCAG
CTCTAGCTCTTTGGACCCAGGTGATGGAGAACCATTCTTTCTGTGAATGACACCCCTGTTTCCAAAGACCCTTTGTCTTC
TTCCCTTTTGGAGATAAAGTCTCTATAAAACCCTGGCTGTGCTATAGCTCACTATGTACAGACTGGCCTTGATTTCACAG
AG
Sequence Type genomic DNA
Unitrap ID UNI4895

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155066731..155067193 427
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047459 (Dynlrb1) NM_025947 dynein light chain roadblock-type 1 Gene [Source:MGI (curated);Acc:Dynlrb1-001]

 
Come back to gene ENSMUSG00000047459


For any suggestions or comments, please send an email to unitrap@crg.es