Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE306G10
Clone ID 5SE306G10
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE306G10
Sequence
GATCTCTGAGTTTGAGGCCAGCTTGGTCTATGTAGTGAGTTTCAGAACAGCCAAAGCTACGTAGTAAGACCCTGCCTTGA
AGAACCAAAACAATAAAAATAAAAAAGAAAGAAAGAAAGAAAGAAAG
Sequence Type genomic DNA
Unitrap ID UNI1052

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147408985..147409108 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029016 (Clcn6) NM_011929 chloride channel 6 Gene [Source:MGI (curated);Acc:Clcn6-001]

 
Come back to gene ENSMUSG00000029016


For any suggestions or comments, please send an email to unitrap@crg.es