Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE306G02
Clone ID 5SE306G02
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE306G02
Sequence
CCCCCCCCCCCCCCCCAAGGGGGTAAGGGGGTTTTTTTTTTTTTTTTTTTTCAAGACAGGGTTTCTTTGTGTCGCCCTGG
CTGTCCTGGAACTCACCCTGTAGACCAGGCTGGCCTCGAACTCAGAACTTACTGACTTAATACTATTGAGGTACATATTG
AAGTCAAATTGTTAAAAAGTCTTAAGTGTTAAAGAGTTCCCTGAGGACACCAGAGCCCATTCAGTAATTTGAATGCAGAG
ACCTTATAAAACAAAAACTGGGCAATGATGCTCCCATTTAAATTCCAGTGCCAGGAGACTAAGACAGAAAGGTTGCCTGT
TGGCTAGCCTGGTCTACAGAGTGAGACCTTTTCTTAGCTGGGGTCATTTTTGAGGCTCAGTTTGGTACAAATGAACCTGG
ATATTTTTTGTTTCCTGTCACTCAGGTCCAGTGCTCGTGCCAACATCACGCTG
Sequence Type genomic DNA
Unitrap ID UNI26454

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8964069..8964520 428
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071653 (1810009A15Rik) NM_025463 RIKEN cDNA 1810009A15 gene Gene [Source:MGI Symbol;Acc:MGI:1913526]

 
Come back to gene ENSMUSG00000071653


For any suggestions or comments, please send an email to unitrap@crg.es