Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE284D06
Clone ID 3SE284D06
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE284D06
Sequence
TTTTTTCGGATAGTTAACGTGGCACATGGCTGCACCTCAGATTTCTGTATCTGAAACAGACAGCTACTCCTCCATCTCTG
GATTCAAAAAGTGTGAAAAGTGCTATCTTCTAGTACTGTAGTGTTGAGAGGTGAATCCATCTACCTAACAGGAAGTTTCC
TCTGAGCTCTGTTTGCTACTGGTGATGTTCTCTGAGAAGTTTGGAAACCTTGGTTAGGAAGTGTTTTCACGATAGACAAG
AGCAAAAATCCAATATTTTCAGCAGTGCCTTTAATAGTTGACCATGAAAAGCACTCTTTTAATTCAAAATAGCTTTCCTA
ATTGTGTGTGTGTGTGTGTGTTGTAGGAATAATATAATTAAAGCAATTAAATACAGAAATGGGCTGGGGAATCTTTCCTA
CATTGTGGGACTTAAAAAAGCAAACAAACCAACCAACCCTTATTTTAAATTACTAAGTCCTGAAAAGATACACTGCCAAG
AATTGTGACCTCCCAGCCAAGTACCAGCTGATCTGGGGGGCACAGTTCCGATTGTTTCCTTTGAATAG
Sequence Type genomic DNA
Unitrap ID UNI17516

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 174288277..174288776 466
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000016252 (Atp5e) NM_025983 ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit Gene [Source:MGI (curated);Acc:Atp5e-001]

 
Come back to gene ENSMUSG00000016252


For any suggestions or comments, please send an email to unitrap@crg.es