Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE284C03
Clone ID 3SE284C03
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE284C03
Sequence
CCGATCATGTTTGTTTTTTCTTGACTACAGTAGTAACATGAGGCCTGCAGCAGAGTGAGACTCCCTAACTTGAGCTATTC
TCATATTGTGTGGCCCACTTTGGCTTTGAGGATGCTTTGCGCTTTTGAGTGGCAACCTCTAGCCCAAGAGTTGAACTCTT
GGTGTATGTTGGGTGTGGTGTTGGTTTCTCTGGTTTTCATTGGGTGTCATTTATCAGTAAAACTTGGAGGTTAGGGTAAT
CCTGACCAATAGAATAAGAGAATCACAGGAAAGGGCGTCTGTCTAATCTGCTTCTCGATTTCTCAGCCTACGTGCTTCCC
AAGCTCTATGTCAAGCTGCATTATTGCGTGACGTGTGCCATCCATAGCAAGGTTGTTAGGAATCGATCCCGCGAGGCCCG
GAAGGACCGAACACCCCCACCACGATTCAGACCTGCTGTAAGTAAATTATTTTAACTTGGGACATACATAGTCTTACCCA
GAGAAGTATCCATTAAGGTCTTATTTAGTCTGTGTGGCAGCTACNACCCTACATATTAAATTTAAAAATGCTTGTCTGTT
TTGCATAACCTGAAACACTTTTAGTGATGCTA
Sequence Type genomic DNA
Unitrap ID UNI86

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 128062109..128062695 546
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025362 (AC117232.3) NM_013765 40S ribosomal protein S26 [Source:UniProtKB/Swiss-Prot;Acc:P62855]

 
Come back to gene ENSMUSG00000025362


For any suggestions or comments, please send an email to unitrap@crg.es