Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE284A06
Clone ID 5SE284A06
Vector rsFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE284A06
Sequence
GGCTACTTTTACTCAAATTGCTATAAAATCTTTACTGACAAACTTTATGGAAGAAGAATGTTGGTCAAATAAATGTTAAT
AAACCTCTGAAGCTATCTTAAAGTATATGTTGCATTGAAGGTTAAGGGGATCTAAACGTATGCATTGAGGTCTAAAAGTC
AGTTCCTCAAAGACAGTTAAAAGTCTTGTTTTTTCCCCTAAACACTTTTGATTTACTAAAGGATTTTTTGCTTGCTTATT
TTATTTGTTTTCATGTGAATGGGCCTTTGTGCAGGGAGGCCAGCAGGTGCTGTCAGTCAGTCCTACAGCTGTGCTAACTG
ATGATCACTGTGACCCATCCGTGG
Sequence Type genomic DNA
Unitrap ID UNI36915

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 99488332..99488676 325
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033166 (Dis3) NP_082591 DIS3 mitotic control homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1919912]

 
Come back to gene ENSMUSG00000033166


For any suggestions or comments, please send an email to unitrap@crg.es