Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE224G09
Clone ID 5SE224G09
Vector rsFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 5SE224G09
Sequence
GATCTGTGTCTGTGCCTGGAGCTGATTACCTGAGAGTTTAGGAGGCTCAGTGTCTGCACAGACTGCCTAAGGAAGAG
Sequence Type genomic DNA
Unitrap ID UNI30688

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11728534..11728610 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020182 (Ddc) NM_016672 dopa decarboxylase Gene [Source:MGI (curated);Acc:Ddc-001]

 
Come back to gene ENSMUSG00000020182


For any suggestions or comments, please send an email to unitrap@crg.es