Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE223G07
Clone ID 3SE223G07
Vector rsFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 3SE223G07
Sequence
GGCTTAGTTTCTTAGCTCAATGATCACGCATCGGTAGTCCAGTGAACTTATTTATGGGAAATTCCAGAAGTTAACATACT
GTCTGAGGCCAGTCGGGTTCTGTTATGCCCTTGCAAACTGTTAAGAGCTCGAATGTTAGTGTAAAAGAATCATTGGAACT
TTGACTATTTTAGGATTTAAGAAAAGAAAAAAAATCTTTAGATTCTTTTTTACCTTCATGTTTGGTTGATGTTGATGATG
GATGGTAAGACATGGCCTAGTGTAGTTCGTGTTGACTTTGAACTTGCTATGTGGCTGTATATAGCAGTGGAGGCCTGATC
CTCTGGCCTCCACCTTCCAAATGCTGGATTATAGGCGCAGGNTGATAGAACCTAGTGGGGAAACCCCCACTCAGCTCCCG
ATTCGTCGTGCACCCAAGAATCACGAATAGAACACAACACCTTGATGTAACAACACGAGGTATTTT
Sequence Type genomic DNA
Unitrap ID UNI14461

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21865193..21865654 428
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024754 (Tmem2) NM_001033759 transmembrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:1890373]

 
Come back to gene ENSMUSG00000024754


For any suggestions or comments, please send an email to unitrap@crg.es