Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SP147C08
Clone ID 3SP147C08
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SP147C08
Sequence
TTGTAGGNNNNTGTGNAAGCCATAGTGCATGTAAAGTTGTTAGAAGGATGTATGGATTGGAGCTACTATTCCAGTTGAAC
GGCTTAAGTGTGTTTCTCTGAGGAACTCACAGCTCTAAGTGAGCAGAAGGGATGATGCTAGAATTTCTCTGCCATTGCTT
AAAGAAATCTTGTTCTTCCCTGCCTTCCCAGCAACCACCACCATCCCACAGGTGTGTTTTCCTTTTCTTTCTTT
Sequence Type genomic DNA
Unitrap ID UNI3537

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7406912..7407145 224
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024969 (Mark2) NM_001080390 MAP/microtubule affinity-regulating kinase 2 Gene [Source:MGI Symbol;Acc:MGI:99638]

 
Come back to gene ENSMUSG00000024969


For any suggestions or comments, please send an email to unitrap@crg.es