Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SP140A06
Clone ID 5SP140A06
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP140A06
Sequence
AATTTGATTAACATATACTTGGATACAATAGAGATGATGCTATAAATACAAGGGAGGTGTGAGCATG
Sequence Type genomic DNA
Unitrap ID UNI683

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53972329..53972395 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]

 
Come back to gene ENSMUSG00000039191


For any suggestions or comments, please send an email to unitrap@crg.es