Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SD078C02
Clone ID 5SD078C02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD078C02
Sequence
AAATCTGAAGGCTTGTGGAAAATGTAAAGGACTTAGAAAATGAAAACTTTGGCCATTGTTTTTAGATTTTTGAGGGTGAC
AAAAGTGTCACTTTTAAAACACACATTTTAAATCCTGGGAAAACCCAGGGAGATGACCTCTCTCTCGGAGAGGCTTACTG
TCCTGAATCCTTCCAACAACTGAAGAAGTCTTGTTTCTACTTAGGTTTTCCTTCTGGCTTGTTACGTATCATA
Sequence Type genomic DNA
Unitrap ID UNI9266

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 120946052..120946284 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048402 (Gli2) NM_001081125 GLI-Kruppel family member GLI2 Gene [Source:MGI Symbol;Acc:MGI:95728]

 
Come back to gene ENSMUSG00000048402


For any suggestions or comments, please send an email to unitrap@crg.es