Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SD076D08
Clone ID 3SD076D08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD076D08
Sequence
GCCTCCTTGGGAGTGAGTGGGCCCCTTGTCTTGAAGAGGGAGAGGGTGTGGGCAGCCCTGGTGTGCGACTGAATCACTCC
CTTCTCTTCCTTGGCCTCTGGCCAGCTGCCTTCTCAGACCAGTGATGTCATAACACGCTGACCTGAAGGTGTGGGGTTGC
TTGGTACAGTTCCCTCTGGGATGAGGTCTTGAGGGGAACCAGCCTGGCCTTCATTCAGAAGACTGGGCCCTGCATACATA
GAGGTGAGTGGAGCGGGCCGACGTGTTGGGGTGCATATGAGAGGTGGATAATCCCGTGTTGTAGCTTGGGGAGGAGCTGT
GACCTCCACTTCTTTGCCGAGATGTTATTCCTCCTGTGGTTACCAGAGGAGGGAAGCTTGCTTGTTAGGTTGCCATATAT
TCCTAAGAATATGGTAGGTTGTTTTGGAGGGGAAAAAATCGTCTTGGCTGGAAGTGGCTTGTCACATCTACTTCTCTGTG
GGAATTTGTGACTTCGCTGTTGCTGTTGCAGAGAGAGAGCAAGGTGGGCTGGCGCCTTTTAGCTACATGGTATGGAGAGA
TAGAGGAGAGATTGACGCACAGTGCAGGTGCTTGTGTGGACTGGGTCCCCAGACCTCAGAGGCAGTTTTGGGTCTGTGGA
TTTCATGGCAGTATAGTGTTGGAGGTGAGCTGNNNAAAGCAGGGAGGGGGATNNNTTTGAACCTTCGTT
Sequence Type genomic DNA
Unitrap ID UNI36921

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 32656971..32657680 684
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022791 (Tnk2) NM_016788 tyrosine kinase, non-receptor, 2 Gene [Source:MGI (curated);Acc:Tnk2-002]

 
Come back to gene ENSMUSG00000022791


For any suggestions or comments, please send an email to unitrap@crg.es