Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SD074G01
Clone ID 5SD074G01
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD074G01
Sequence
GGATCTGTATTAGATAAACATGTGCAATCCTTGGGTGACATATTTAAGTGAGCTCAAAAATGTAAAACACATGCCATTAC
TTGTAACTGTGTGTGTCACATTATAGGTCTCAGTAGTTAAGAAAGCACATAGGGGCAAGGTCAAATGCTATCTTATTAAT
GCCATTTCTTCTACCAGGAAGGGCCTAATCTTTTTCAAATCTGTACAGG
Sequence Type genomic DNA
Unitrap ID UNI3415

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177499641..177499849 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078864 (OTTMUSG00000016321) predicted gene, OTTMUSG00000016321 Gene [Source:MGI Symbol;Acc:MGI:3652185]

 
Come back to gene ENSMUSG00000078864


For any suggestions or comments, please send an email to unitrap@crg.es