Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SD071D07
Clone ID 3SD071D07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD071D07
Sequence
CCTTCCTATTATGTTCTCCCAACCCAATCGGCCAGAGAAAGCCCACCCCCTCCAGCGTAGAGCCATCTATGCTCCCTGCT
CTGTGGTGAGGCCAGCATTGCCAAGGGTGCTACAGGAGTGTGCACTGGCACCCAACAAGGTCATCTGCTTCTGGAGAGTA
AGTGAGAAACAACCTCTAGGGATTATAAGTGGCCAAAGGAGAGCGCTGGCTTCAGGCTCCCAGGAGAGAGAATGGCAGGC
GAGGAGGGAGGAGGCTGGGTGCTTGGCCCCTCTAAGCTTATCAGAAGAGCTTCCGAAGAAAACTATGGGGGAGGTGTGGT
CAGGGGAGAGGGTAGAAGGGTTCTGGGTTTGCAAAGATAGTCTTCCAAAAGTGAACTGGCTGGATAAAGGGAAGTGGGCC
AGNNNGTGAAAGCTGCCCTGGAGGCTGTGGATGGGAGCTCTGCCTGAGCCTGAGGGGTCATTTAAGCAATGCCTTGGGAT
TACTGAACAGCAAGGAGAGAAACTTGTACCAAGAATGAGGAGGACCCAGTTACCCACCAGGAGGGTGATGCTCAGGGTCC
TGCTGAGATTGCAACTACATATTCCAAAGACTCTATTCTCCCCACTCTTGCGGAACTGTACCAGGAACCAGTGAAGACCA
AGCAGCAGCACAGCTTACTCAAAGAGCAGGCCCTTACTCCCATCCCTTAGGCTGCTCTCACTGTAATGGGCACTGGATGC
TAGCAAAAGTCCTGACTTCATCTCAGTCCAGAAAGGACCCAAGGAGACGATATACCTGTTACAAAATGGCTGTCAATAAA
TTTTGCTAGGGAGGAAAATGAAAAGTGGGCTAAAGGTGCAAGCATCAGCTGGAAAAGTCAGAAGAGC
Sequence Type genomic DNA
Unitrap ID UNI5311

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96830137..96831004 852
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018678 (Sp2) NM_030220 Sp2 transcription factor Gene [Source:MGI (curated);Acc:Sp2-001]

 
Come back to gene ENSMUSG00000018678


For any suggestions or comments, please send an email to unitrap@crg.es