Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SD062B03
Clone ID 3SD062B03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD062B03
Sequence
CCCTGATGGCAGGGGAATTGCAGATGGCTTCACGCTTTCAAGTCAAGCATAGGAAACAAGATTGGTGGAGTGAAAGTTTG
GAAAGGGGAATTCCACAACAGCGCTTTCACGCGGAGACACTTGACAGTGAATGGGCTTTTGTCCTTTACAAAATCGTGGA
GTTAGTGCATTCTGATGTCAGACCTAGTTTTCATTTACAGACTGTAGACTTGTTGCCAAAAGTGCTCCCCATTCTCCCCA
ACTAGCGCT
Sequence Type genomic DNA
Unitrap ID UNI36924

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 102527806..102528054 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032534 (AL450317.13) NM_001081122 centrosomal protein 63 [Source:RefSeq peptide;Acc:NP_001074591]

 
Come back to gene ENSMUSG00000032534


For any suggestions or comments, please send an email to unitrap@crg.es