Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SD060H06
Clone ID 3SD060H06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD060H06
Sequence
AGAGGGAGCTCTAGAGCATGGGGCCTCTCTGTTCAGAAGACAGATCAGTAGTAACTAGGGTCAAATTTATAACAGTTTAG
GGGTGACTTTGAGTTATCTTTATTGGAGTCATGAAATATGATTTTATTTTATTTCTATACACACACTAGCACAGGTAACA
TTAGTCAAGTTCACATTGTTCCTGGTGTAGTTGCCTTAGTTATTGAAAAAAAGTTGAAAATTGGTCACATGGAAATGGGC
AGAGGAAGCTTTCCCTGATACTGTGTTGCAGTTCTGTGG
Sequence Type genomic DNA
Unitrap ID UNI14331

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177102709..177102987 279
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078868 (OTTMUSG00000016580) predicted gene, OTTMUSG00000016580 Gene [Source:MGI Symbol;Acc:MGI:3652251]

 
Come back to gene ENSMUSG00000078868


For any suggestions or comments, please send an email to unitrap@crg.es