Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST421309
Clone ID OST421309
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST421309
Sequence
CAGGCCCACAGACTCCACAGTCAACTGGGAGCAATTCGATGGCAGAGGTTCCAGGTGACCTGAAGCCACCAACCCCAGCC
TCTACCCCTCATGGACAGATGACTCCCATGCAAAGCGGAAGAAGCAGTACAGTCAGTGTGCATGACCCGTTCTCAGACGT
GAGTGACTCAGCGTACCCAAAACGGAACTCCATGACTCCAAACGCCCCATACCAGCAGGGCATGGGCATGCCAGACATGA
TGGGCAGGATGCCCTATGAACCCAACAAGGACCCTTTCAGTGGAATGAGAAAA
Sequence Type mRNA
Unitrap ID UNI18529

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 5327295..5327820 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069729 (Arid1b) AT rich interactive domain 1B (SWI-like) Gene [Source:MGI (curated);Acc:Arid1b-001]

 
Come back to gene ENSMUSG00000069729


For any suggestions or comments, please send an email to unitrap@crg.es