Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SD059B05
Clone ID 5SD059B05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD059B05
Sequence
AGTAGGAAGGAGTCGGACTCAGAGGTGCGTGAGTCCCTGAGAGAAGGGCAAGTGGCTCCGCTACCCCATTCCTTCAGATT
CTCCGCCAGGACGTATAGTCACAGCGCCTTCACTTCCGGGTCCGCCATTTTATTGCCTCCATTTCTCCGTGAGGGGGGGT
AAGGGCCCCCCCAAATATGCATATGTGAAAAGGCCGAAAAGTGAGGNCGCTGGCAAGGAGTCTTAACTAGAGAAAGAAAC
GGGACCAAACTGGCGGGCCCAGTGAGAGCGAAGCCGGCAGCGCTCCGGAATAGGTGAGGGGGAAAGGACACGCAGGGTTC
CGGAGCTTCCG
Sequence Type genomic DNA
Unitrap ID UNI21607

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95021473..95021807 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038766 (Gabpb2) NM_172512 GA repeat binding protein, beta 2 Gene [Source:MGI (curated);Acc:Gabpb2-004]

 
Come back to gene ENSMUSG00000038766


For any suggestions or comments, please send an email to unitrap@crg.es