Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SD058G07
Clone ID 3SD058G07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD058G07
Sequence
CAAACCCCCATGAAGTGTTGGAGAGGCAGCATCAGTCACATGGGCAAAGGCCACAAGCCACGCAAGGCAGACAACAGATA
ATCCACACAGGGTTGGCCTTCCCCCGCCCCCTACTTTGATTAGTTTCTGGAGG
Sequence Type genomic DNA
Unitrap ID UNI9918

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 119485317..119485449 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028134 (Ptbp2) NM_019550 polypyrimidine tract binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1860489]

 
Come back to gene ENSMUSG00000028134


For any suggestions or comments, please send an email to unitrap@crg.es